Letter to the American Church – Chapter 1


As Christians we must shred calls to avoid politics. Without Christian faith in politics, moral values have been suppressed and nearly made illegal. This post provides a great picture for the reason Christians MUST be as vocal politically as they are for their Religious Liberty!

Thank you to those who have stepped up!

READER SUPPORTED! I need Readers willing to chip in $5 – $10 – $25 – $50 – $100. PLEASE I need your generosity. PLEASE GIVE to Help me be a voice for Liberty:

Please Support CPCR

YOU CAN ALSO SUPPORT via buying healthy supplements/products from Online stores (mine & my Honey):

Mine: https://modere.co/3SrOHzI

My Better Half: https://valentus.com/dianahouk

Big Tech Censorship is pervasive – Share voluminously on all social media platforms!

**********************

No Thought Police

Chapter 1

What Is the Church?

“See, I have set before you today life and good, death and evil. If you obey the commandments of the Zlord your God that I command you today, by loving the lord your God, by walking in his ways, and by keeping his commandments and his statutes and his rules, then you shall live and multiply, and the Lord your God will bless you in the land that you are entering to take possession of it. But if your heart turns away, and you will not hear, but are drawn away to worship other gods and serve them, I declare to you today, that you shall surely perish. You shall not live long in the land that you are going over the Jordan to enter and possess. I call heaven and earth to witness against you today, that I have set before you life…

View original post 4,944 more words

Actual Science of mRNA Deaths & DNA Alterations


John R. Houk, Blog Editor

© February 28, 2022

I am not actually a science-oriented person. HOWEVER, I can read. Today I am sharing info from science oriented people. If you can refute the data with a science rebuttal that is not a simple fake Globalist-science admonition of “fake,” “false” – without the reason, “misinformation” by telling why without character assassination, and YOU GET THE IDEA; then I’d love to read the scientific refutation. If you cannot, I’ll just call you a Left-Wing lying propagandist trying to maintain Globalist-Marxist control of the population via fearmongering.

The first cross post is explanatory from the title: “Official Government Data: Twice as Many Deaths Following COVID-19 Vaccines in 1 Year as Deaths Following All Vaccines for the Previous 30 Years.”

The next two cross posts are related to the science-deep reporting of Igor Chudov on Substack. Those posts are full of links and diagrams to actual scientific studies that stretches my mind to comprehend but Chudov makes the effort to make the science comprehensible.

FIRST Chudov article: I’m using the NWO Report version because it’s simply easier to read than the Substack version was posted on 2/25/22: “Bombshell New Study Proves Pfizer mRNA Vaccine Permanently Alters Human DNA.”

SECOND Chudov article: Is from his Substack page: “DNA Transcribed from Pfizer mRNA Vaccine Contains MUTANT gp130 Tumor Gene.”

JRH 2/28/22

I need your generosity. PLEASE GIVE to overcome research expenses:

Please Support NCCR

Big Tech Censorship is pervasive – Share voluminously on all social media platforms!

**************************

Official Government Data: Twice as Many Deaths Following COVID-19 Vaccines in 1 Year as Deaths Following All Vaccines for the Previous 30 Years

By Brian Shilhavy Editor, Health Impact News

February 26, 2022

Vaccine Impact

Comparison VAERS Vaxx Data

The latest data dump into the U.S. Government’s Vaccine Adverse Events Reporting System (VAERS) happened yesterday (2/25/21) and covers data through 2/18/2022.

This data is supplied by the FDA and the CDC.

Since December of 2020, when the COVID-19 vaccines were issued emergency use authorization, there are now a recorded 1,134,984 cases of deaths and injuries.

1-Year-Data-Covid19-Vaccines

Source.

There are now more reported cases of injuries and deaths following COVID-19 vaccines for the past year than there were following all vaccines for the previous 30 years before the COVID-19 vaccines were authorized.

30+ Years Data Cases VAERS

Source.

And there are now almost twice as many deaths recorded following COVID-19 vaccines in its first year than there were recorded in the previous 30 years before the COVID-19 vaccines were introduced.

Why are we still doing this?

Here is the CDC’s response after publishing this data:

CDC (DECEPTIVE) response to Data

Comment on this article at HealthImpactNews.com.

See Also:

Rumble VIDEO: In Memoriam: Victims of COVID-19 “Vaccines”

[Posted by HealthImpactNews

Published August 2, 2021

There are no second chances after you take the shot(s) and your family and friends mourn you at your funeral.]

MORE Information on Page TO READ

Copyright 2022 Health Impact News 

Vaccine Impact HOME PAGE

+++++++++++++++++++++

Bombshell New Study Proves Pfizer mRNA Vaccine Permanently Alters Human DNA

Pfizer Jab

Posted by Nwo Report

Source: Igor Chudov

February 27, 2022

NWO Report

For over a year, our trusted “health experts and fact checkers” have been telling us that mRNA vaccines, including Pfizer and Moderna, do not integrate themselves into human cellular DNA. However, a bombshell new study published in Current Issues of Molecular Biology shows that the health experts and fact checkers were wrong.

Lab studies show that mRNA vaccines DO integrate themselves into human cellular DNA. In essence, the vaccines change your DNA forever.

Intracellular Reverse Transcription Pfizer

What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cells.

Mainstream media and fact checkers have dedicated themselves to telling us the opposite:

MSM Disinformation Lies

However, the bombshell article from Current Issues of Molecular Biology suggests they have been spreading disinformation all along.

A new study is out: Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line.

IgorChudov reports:

What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cells.

However, the bombshell article from Current Issues of Molecular Biology shows the opposite.

Molecular Biology Abstract screen capture

What the article shows is that in vitro, using a human liver cell line, Pfizer mRNA vaccine uses a natural reverse transcriptase enzyme called LINE-1, and the genetic code of the vaccine is reverse transcribed into the DNA.

It also explains that vaccine mRNA actually does travel to the liver as one of the preferred sites (the other sites, as we heard, are ovaries and more).

What does it mean? Normally, our cells do the opposite: the cell nucleus, where the DNA is, expresses certain DNA code based on conditions of the cell, and produces natural, human messenger RNA. That messenger RNA travels out of the nucleus, where it is expressed into proteins needed for cell building. This is how growing organisms express different genetic programs to grow muscle cells or brain cells, etc.

This process is called “transcription”.

For many years, Central Dogma of Molecular Biology stated that the “reverse transcription” — moving genetic code from RNA back into the sacred cellular nucleus and recoding the DNA — was impossible. Eventually, scientists realized that it is possible under various conditions. For example, the HIV RNA virus is able to do so and it reprograms our DNA to produce copies of it. HIV is the virus that causes AIDS.

To effect reverse transcription, enzymes called “reverse transcriptases” are needed. One of them is called LINE-1.

Apparently, per study, the Pfizer mRNA vaccine causes cells to produce that LINE-1 enzyme.

Pfizer mRNA vaccine causes cells to produce that LINE-1 enzyme

After seeing LINE-1 reverse transcriptase rise, they tested for alterations to the DNA, making sure they are not picking up the RNA instead.

Transcribed DNA Seen NOT RNA

The genetic code that they picked up is:

  • CGAGGTGGCCAAGAATCTGAACGAGA
  • GCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACA
  • TCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTT
  • GCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCAAGT
  • TCGACGAGGACGATTCTGAGCCCGTGCTGA
  • AGGGCGTGAAACTGCACTACACATGATGAC
  • TCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGA
  • GTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCT
  • CTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA

Anyone wants to run BLAST on it?

Simplified

As I explained in response to a questioner:

Pfizer mRNA vaccine changes our genetic code that determines how our organisms operate, that you inherited from your mom and dad. Now your DNA was changed from what your mom and dad gave you, by adding a little mysterious “edit” from Pfizer.

Your organism acts in accordance with your DNA program, and now, well, the program has been hacked and modified by Pfizer.

Cancer Code

Considering that Sars-Cov-2 “spike protein” has cancer code from Moderna 2017’ patent 9,587,003, it is imperative to find out the implications of this reverse transcription, and whether the vaccinated now have any undesirable genetic code embedded into their DNA.

Of particular interest is whether this mRNA-induced reverse transcription affects the “germ line”, such as eggs and sperm cells, and whether it also affects the fetus of pregnant mothers.

Please repost this article far and wide due to its big implication for our public health.

EDIT: Our astute commenter pointed out an anonymous 4chan post from Dec 2020, long before any of this became known. The date makes us all ask, did this person know too much?

mRNA and S Protein data

© 2022 NWO REPORT

++++++++++++++++++++

DNA Transcribed from Pfizer mRNA Vaccine Contains MUTANT gp130 Tumor Gene

Having fun BLASTing DNA Reverse Transcribed from Pfizer Vax

By Igor Chudov

2/27/22

Igor’s Newsletter

My previous post about a science article proving that Pfizer mRNA vaccine reverse transcribes into human DNA, has garnered enormous interest and lots of comments, may of which were incredible.

If you did not read it yet, PLEASE READ IT FIRST before reading this article. Otherwise you may get lost and not even realize the significance of how your loved ones’ genetic code may have been reprogrammed. Here you go:

I decided to continue plodding along and see what else we can uncover, based on that “Current Issues in Molecular Biology” article:

Igor Newsletter- Reverse Transcription

The article contains a printout of genetic DNA code that was detected in human cell DNA materials reverse transcribed from the mRNA vaccine.

printout of genetic DNA code 

So, I decided to check what is actually in this code above, is that just harmless junk or something more ominous. For that, I ran a free NCBI “BLAST” tool by copying and pasting the above genetic sequence in it. This is the same BLAST tool that @JikkyKjj used to show a Moderna “cancer patent” sequence on the most important, “furin cleavage site” of Sars-Cov-2. I wrote about that also:

Anyway, impressed with @JikkyKjj’s discovery, I decided to do the same with the DNA code that Pfizer mRNA vaccine generates (reverse transcribes) into human cells. Turns out that I was the first to enter that sequence into the NCBI BLAST tool (because it took a while to analyze) and it now has a sequence ID of 1R3ZDZJY016.

And here are the results. I annotated them to make it easier for you to see what is and is not interesting.

Igor Annotations

The first few results are from the usual suspects such as chimeric viruses, Sars-Cov-2 sequences, etc. It is understandable why we should ignore them — the chimeric viruses are pure lab constructs of unknown significance, and Sars-Cov-2 sequences are obviously there because the vaccine encodes Sars-Cov-2 spike protein. Those are “expected matches”.

What is interesting — and I am not saying it is the only thing — is the gp130 glycoprotein gene that is 97% similar to the human gp130 glycoprotein gene. The chance of that being a random coincidence, per BLAST tool, is 0.000000000000000000000000000000000000000000000000000000000002.

I clicked on it:

Red Dots Show gp130 Mutations

You can click on the “Gene” link to see what that gp130 gene is about:

TLE family member 5

Where this gene is used

So, we have Pfizer Covid mRNA vaccine reverse transcribe to a MUTATED gp130 gene. Remember the 97% match? The 3% non-matches, the four red dots, are the mutations of the gp130 gene.

So, without looking at these specific mutations, what happens when gp130 gene mutates in general? Nothing good comes up and you can search for it too.

Liver Cancer focus

Please note that a question arises: gp130 mutations can cause liver tumor, and the entire experiment was performed on a line of immortal liver cancer cells. Could it be that the original article picked up mutated gp130 from the Huh7 liver cancer cells? If that is the case, if the DNA sequence is inherent to Huh7 line itself, it could invalidate a lot of conclusions that the original science article, as well as my own articles, were making.

However, the authors were diligent with controls and did NOT see the questioned DNA sequence that I am looking at, in the control cells that did NOT receive the Pfizer vaccine. In addition, the published DNA sequence contained Sars-Cov-2 genes (see BLAST results), so it does come from the effect of the vaccine, not the Huh7 culture cells.

No DNA in Controls

I did perform some cursory checks, to the best of my ability, and the Huh7 line contains p53 mutations, but it does not seem like it contains gp130 mutations.

So, keeping my fingers crossed, the mutated gp130 gene that I found, is a genuine finding of lab research, comes from the mRNA vaccine, and not a coincidental pickup from the Huh7 cells.

I am guessing that the authors were looking at liver cells specifically, because they knew where to look (that the mRNA delivery system delivers the lipid nanoparticles to the liver). Why did the authors pick liver cells? Maybe because they heard of this 4chan post from 2020, when NOTHING yet was known about the strange mRNA vaccines:

mRNA Mostly Ends Up in Liver

[Blog Editor: I’ve noticed Nwo Report authors have spliced some of the photo arrays from this point in their post above. If you choose to read it at the Igor Newsletter Substack go HERE.]

© 2022 Igor Chudov

The Third Doctors for Covid Ethics’ Symposium (18 February 2022)


Doctors & Science not dominated by Globalist-control double-speak lies! https://johnplatinumgoss.com/2022/02/20/the-third-doctors-for-covid-ethics-symposium-18-february-2022/

All the Goss

On a day when world experts from the medical, scientific, legal and financial sectors brought knowledge, insight and hope to the world, Bill Gates was still riding the vaccine waggon from which the wheels long ago came off. Gates’ latest message is just more of the same with a statement that is as ludicrous as it is false.

“Sadly, the virus itself – particularly the variant called Omicron – is a type of vaccine. That is, it creates both B-cell and T-cell immunity, and it’s done a better job of getting out to the world population than we have with vaccines. . .”

Bill Gates at the Munich Security Conference, 18 February 2022

Had he said that the body’s immune system was a better defence than any vaccine he would have been much closer to the truth. That message is something that Sucharit Bhakdi has been saying for two years…

View original post 2,709 more words

Vaccine Cult Exposed by Government’s Own Data…


The DOCUMENTED data is official. VAERS show adverse reactions from COVID-Jab in the last 11-months than all the rest (legit non-mRNA) vaccine adverse reactions the last 30-years. AND WE ARE STILL told the LIE mRNA Jabs are safe and effective with one-time Free-World imposing tyrannical Jab mandates.

JRH 12/2/21

I need your generosity in 2021 PLEASE GIVE via – credit cards, check cards & debit cards are accepted by my PayPal account:

Please Support NCCR

Or if not donating you can support by getting in the Coffee from home business earning yourself extra cash – OR just buy some TASTE GOOD healthy coffee, that includes immune boosting products. Big Tech Censorship is pervasive – Share voluminously on all social media platforms!

***********************

Vaccine Cult Exposed by Government’s Own Data: More than 50% of ALL Vaccine Adverse Reactions Reported for Past 30+ Years Have Occurred in Past 11 Months Following COVID-19 Shots

VAERS-Vaxx Graph. All Vaxes 30 yrs. vs COVID-Jab last 11 Months

By Brian Shilhavy Editor, Health Impact News

November 30, 2021

Vaccine Impact

The latest data dump into the U.S. Government’s Vaccine Adverse Events Reporting System (VAERS) happened late yesterday afternoon (11/29/21) and covers data through 11/19/21.

The VAERS database was mandated by Congress over 30 years ago, beginning in 1990, and is maintained by the U.S. CDC and FDA.

As of yesterday’s update, there are now a total of 1,765,262 cases of adverse events following all vaccines for the past 30+ years, including the experimental COVID-19 shots that have been issued emergency use authorization and are not yet approved by the FDA (source).

(Note: The FDA did approve one of the Pfizer shots, but the one they approved is not in circulation within the U.S. at this time.)

Of those 1,765,262 cases of adverse events following all vaccines for the past 30+ years, 913,268 of them (52%) have been reported during the past 11 months following COVID-19 shots (source).

68% of ALL Recorded Deaths Following Vaccines for the Past 30+ Years Have Followed COVID-19 Shots for the Past 11 Months

For the past 30+ years there have been 28,379 deaths recorded in VAERS following all vaccines, including the COVID-19 EUA shots.

68% of those deaths, 19,249, have followed COVID-19 shots in the past 11 months. (Same sources as above.)

61% of ALL Recorded Life Threatening Events Following Vaccines for the Past 30+ Years Have Followed COVID-19 Shots for the Past 11 Months

For the past 30+ years there have been 35,524 life threatening events recorded in VAERS following all vaccines, including the COVID-19 EUA shots.

61% of those life threatening events, 21,582, have followed COVID-19 shots in the past 11 months. (Same sources as above.)

60% of ALL Recorded Permanent Disabilities Following Vaccines for the Past 30+ Years Have Followed COVID-19 Shots for the Past 11 Months

For the past 30+ years there have been 51,231 permanent disabilities recorded in VAERS following all vaccines, including the COVID-19 EUA shots.

60% of those permanent disabilities, 30,967, have followed COVID-19 shots in the past 11 months. (Same sources as above.)

55% of ALL Recorded Hospitalizations Following Vaccines for the Past 30+ Years Have Followed COVID-19 Shots for the Past 11 Months

For the past 30+ years there have been 178,383 hospitalizations recorded in VAERS following all vaccines, including the COVID-19 EUA shots.

55% of those hospitalizations, 97,561, have followed COVID-19 shots in the past 11 months. (Same sources as above.)

20% of ALL Recorded ER Visits Following Vaccines for the Past 30+ Years Have Followed COVID-19 Shots for the Past 11 Months

For the past 30+ years there have been 507,064 ER visits recorded in VAERS following all vaccines, including the COVID-19 EUA shots.

20% of those ER visits, 101,373, have followed COVID-19 shots in the past 11 months. (Same sources as above.)

(Note: It is well-reported that there have been a shortage of hospital workers this year, with some ERs even closing completely, so it is very likely that this percentage of ER visits following COVID-19 shots would be even higher if the nation’s hospitals were working at full staffing as in past years.)

Conclusion: The Government’s own Data Show that COVID-19 Experimental Shots are NOT Safe!

After reviewing this data supplied by the U.S. Government, how can anyone conclude that the experimental COVID-19 shots are safe?

With all the boosters being rolled out now, one might be tempted to think that there have been exponentially more COVID-19 shots administered than in previous years to account for these large numbers.

But we are talking about 11 months of data for ONE single class of “vaccine” compared to ALL vaccines for the past 30+ years!

It would probably take considerable time to research how many doses of every kind of vaccine have been distributed for the past 30+ years since 1990, but we do have totals supplied by the CDC for one of the classes of vaccines, the annual flu shot.

According to the CDC, from 1990 through 2021, there have been over 3 billion flu shots (3,104,500,000) distributed in the U.S. (Source.) The 2020-2021 flu season alone distributed about 194 million flu doses. (Source.)

In comparison, according to the CDC, for the three currently authorized COVID-19 shots, there have been 459 million doses distributed in the U.S. through November 30, 2021. (Source.)

So just for one vaccine, the flu shot, there have been 6X more shots given for the past 30+ years, and that does not include the many dozens of other vaccines given over the past 30+ years, mostly to children.

These COVID-19 shots are not safe. They are deadly.

And when we discuss children, this whole vaccination eugenics program turns very dark, and very evil.

All Vax Deaths by Age for 30 yrs.

When we search for all the recorded deaths following FDA-approved vaccines for the past 30+ years, about 50% of those deaths have been recorded for children under the age of 3. (Source.)

The COVID-19 EUA shots have not yet been approved for this age group, although Moderna and Pfizer are currently conducting trials on children between the ages of 6 months old and 4 years old, and Anthony Fauci has promised us that these shots will be authorized for this age group after the first of the year (2022).

So while 68% of ALL deaths following injections have occurred in the past 11 months following COVID-19 shots, 19,249, only 4 of those deaths have been recorded so far in children under the age of 3. (Source.)

One of those cases appears to be an error (death by suicide; 12/26/20, self-inflicted gunshot wound), one was a “5 month old breastfed infant,” one was a fetal death in the first trimester, and the other one may be a death from the Moderna COVID-19 vaccine trials for this age group, where the infant had a seizure.

What are these numbers going to look like when they start injecting these fragile babies with these killer COVID-19 shots?

Well, given how many unborn children are dying in the womb of their pregnant mother who received one of these shots, and the historical data that young children are the most susceptible to deaths following vaccination, we should literally expect a massacre.

2732-fetal-deaths following COVID Jab

From the data released into VAERS yesterday, we have found 2,732 fetal deaths, which includes ectopic pregnancies, which is when a fertilized egg grows outside a woman’s uterus, and then the fetus has to be surgically or chemically removed. (Source.)

We have previously reported that ectopic pregnancies following COVID-19 shots have been reported at 50 X more than reported following ALL vaccines for the past 30+ years. See:

VAERS Data Reveals 50 X More Ectopic Pregnancies Following COVID Shots than Following ALL Vaccines for Past 30 Years

Using this same exact search in VAERS to determine fetal deaths following COVID-19 shots for the past 11 months, which found 2,732 fetal deaths, we applied it to ALL vaccines that are non-COVID for the past 30+ years, and it returned 2,163 deaths. (Source.)

That’s an average of about 72 fetal deaths per year following all FDA-approved vaccines for the past 30+ years, compared to what is on pace to be 2980 fetal deaths in 1 year following COVID-19 shots.

  • FDA-approved vaccines: 72 fetal deaths per year
  • COVID-19 EUA shots: 2980 fetal deaths per year

Here is a screen shot from a Social Media thread just recently posted.

twitter-fetal-deaths screen shot

Here is a video we produced in October showing some of the effects of these shots on unborn children.

Rumble VIDEO: 1,969 Fetal Deaths Recorded Following COVID-19 Shots – Criminal CDC Recommends Pregnant Women Get It

[Posted by HealthImpactNews 

Published October 1, 2021

The CDC released more data today into VAERS (Vaccine Adverse Event Reporting System) which shows that there are now 1,969 fetal deaths among pregnant women who received a COVID-19 shot.

By way of contrast, I performed the exact same search in VAERS for all non-COVID-19 vaccines for the past 30 years, and it returned a result of 2,183 fetal deaths from pregnant women following vaccination for the past 30 years.

So there have been nearly the same amount of fetal deaths following COVID-19 shots during the past 10 months, as there have been for the past 30+ years that VAERS has been in existence!

And how has the CDC responded to this data?

This past week the CDC published recommendations for all pregnant women to get a COVID-19 shot!

Full story >>> https://healthimpactnews.com/2021/1969-fetal-deaths-recorded-following-covid-19-shots-but-criminal-fda-and-cdc-recommend-pregnant-women-get-the-shot/]

This is Not About Science or Public Health – This is a Religious-like Vaccine Cult

Praying to Cult of Jab

Faced with this data that comes directly from the U.S. Government’s own VAERS database, which is vastly under-reported as so many medical professionals have now come forward as whistleblowers to reveal how much pressure is being put on them NOT to report these deaths injuries to VAERS (Watch: COVID Vaccine Injuries & Deaths COVER-UP! Nurse Whistleblowers Speak Out on Pressure to NOT Report), why are people still lining up to get these killer shots, and even worse, allowing their children to be injected with them?

We only covered the U.S. Government data in this article so far showing that these experimental shots are very clearly dangerous, but not only are they killer shots, they also don’t work for the main purpose that people have been convinced to take them: to stop the spread of COVID-19 so we can all return to a “normal life.”

This is biggest lie that the pharma-owned corporate media has broadcast to the public, as we have a record of WHO director Tedros Adhanom recently telling Brazilian President Jair Bolsonaro that the vaccines are not even designed to stop transmission, only to prevent serious illness and death. See:

Brazilian President tells WHO Director “People are Dying” After COVID Shots – Pleads with WHO to Publicly NOT Recommend it for Children

Even Bill Gates stated in a recent interview that “we need a new way of doing the vaccines” because they don’t do a good job of stopping transmission. See:

Bill Gates: mRNA Vaccines Don’t Stop Transmission – We Need a New Way of Doing Vaccines

And according to official public data, COVID deaths in 2021 after almost a half billion doses of COVID-19 EUA shots are HIGHER than 2020 COVID deaths when there was no COVID-19 “vaccine.”

U.S. COVID Deaths Graph 2020-21

Source.

And yet, now that we are almost 1 year into the experimental “vaccines,” and we have all this data to show that they are neither safe nor effective, if you present this data to those who are still pro-COVID-19 “vaccines,” it will not convince most of them.

It is a political and ideological issue to them, the facts be damned.

This is the classic definition of a “cult.”

I prefer to use “The Free Dictionary” to look up definitions of English words as opposed to the Merriam Webster dictionary, which is owned by a Jewish Swiss financier, and has changed the definition of “vaccine” several times this year, and even recently named “vaccine” as “Top Word of the Year.” (Source.)

See:

The Evolving Definition of “Vaccine” in the Merriam-Webster Dictionary for 2021

The Free Dictionary website, which uses the more traditional “American Heritage Dictionary,” defines “cult” as:

cult (kŭlt)
n.
1. a. A religion or religious sect generally considered to be extremist or false, with its followers often living in an unconventional manner under the guidance of an authoritarian, charismatic leader.
b. The followers of such a religion or sect.

2. A system or community of religious worship and ritual.

3. The formal means of expressing religious reverence; religious ceremony and ritual.

4. A usually nonscientific method or regimen claimed by its originator to have exclusive or exceptional power in curing a particular disease.

5. a. Obsessive, especially faddish, devotion to or veneration for a person, principle, or thing.
b. The object of such devotion.

6. An exclusive group of persons sharing an esoteric, usually artistic or intellectual interest.

Cult members are usually referred to as “deceived” and “brain washed.”

This is clearly what we are dealing with today, all in the name of “science.”

The Bible refers to it as a “delusion.”

The coming of the lawless one will be in accordance with the work of Satan displayed in all kinds of counterfeit miracles, signs and wonders, and in every sort of evil that deceives those who are perishing.

They perish because they refused to love the truth and so be saved. For this reason God sends them a powerful delusion so that they will believe the lie and so that all will be condemned who have not believed the truth but have delighted in wickedness. (2 Thessalonians 2:9-12)

ADDITIONAL INFO

Copyright 2021 Health Impact News

Vaccine Impact HOMEPAGE

What Reason Dem-Marxists Desire American Civil War?


ASK YOURSELF

John R. Houk, Blog Editor

© November 26, 2024

I took some Thanksgiving time off to be thankful with visiting family that I lived through a horrible 4-car accident. I am back today.

I subscribe to the NWO Report which largely aggregates (a function I also perform) great articles Globalist/Marxist/Dems would rather you not become aware so you do not awaken to the plague of tyranny enveloping American and the once free world for that matter.

The NWO Report cross posted an article they source as Infowars yet focus on a Banned VIDEO posted on November 24. The NWO Report did not provide the Infowars link (so I’m not either) to the article. The article title grabbed my attention: General Flynn Exposes Deep State Plan to Trigger Civil War In Groundbreaking Interview”. Since I’m not looking I am unsure if the Infowars title is the same, but the Banned VIDEO title is a bit different: Breaking! General Flynn, Patrick Byrne Talk January 6th, 2022 Election & More”.

The discussion is led by Alex Jones and the participants are General Flynn, Joe Flynn & Patrick Byrne. According to the NWO Report summary the consensus is that part of the government which is UNELECTED known as the bureaucracy but better to actual Conservatives (as opposed to RINOs or so-called Establishment Conservatives) as the DEEP STATE is purposefully pushing America toward a Civil War.

Now if you are a Conservative weary of Dem-Marxist tyranny (me included), you might think or say, “Bring it! Let’s take America back!”

If the panel discussion is correct, you should ask yourself, “Why would Dem-Marxists want to unleash a Civil War?” From the top of my head the answer is BECAUSE THEY BELIEVE a Dem-Marxist violent victory would settle the control dictatorship.

Without arguing the point one way or another, I’ll leave that thought with you to draw your own conclusions as I cross post (i.e. aggregate) the NWO Report version of the Infowars article. (NOTE: The Banned VIDEO platform does not embed on the WordPress blog platform and the NWO Report is a WordPress website/blog. My SlantRight 2.0 blog allows the embed my WordPress blog NCCR will not. So my NCCR blog will have NWO Report appearance while you’ll be able watch the video on SlantRight 2.0.)

JRH 11/26/21

I need your generosity in 2021 via – credit cards, check cards

& debit cards are accepted by my PayPal account:

Please Support NCCR

Or if not donating you can support by getting in the Coffee from home business earning yourself extra cash – OR just buy some TASTE GOOD healthy coffee, that includes immune boosting products. Big Tech Censorship is pervasive – Share voluminously on all social media platforms!

**********************

General Flynn Exposes Deep State Plan to Trigger Civil War In Groundbreaking Interview

Posted by Nwo Report

Source: Infowars

November 26, 2021

NWO Report

Watch & share this second part of Alex Jones’ bombshell encounter with General Michael T. Flynn!

Joe Flynn, (Gen) Mike Flynn, Patrick Byrne & Alex Jones

Alex Jones hosts a powerful discussion with General Flynn, his brother Joe Flynn, and Patrick Byrne over the Deep State’s plot to implode the nation.

This in-depth encounter between minds details how to stop the bloody civil war globalists are trying to unleash upon America.

The only way this information gets out is by you sharing this video!

https://api.banned.video/embed/619e71c1db80e065c5003563

[Banned.VIDEO: Breaking! General Flynn, Patrick Byrne Talk January 6th, 2022 Election & More

Posted by The Alex Jones Show

Nov 24, 2021

Alex Jones hosts an in-depth discussion with General Flynn, Joe Flynn & Patrick Byrne concerning the deep state attempts to trigger a bloody civil war in America and how we can stop it.

The only way this information gets out is by you sharing this video!

Save up to 60% on our hottest items during the Get Prepared 2021 Mega Blowout Sale now!]

Throughout the discussion, everyone expressed concern over what calamity the Deep State would use to foster a smooth transition to tyranny before the masses can galvanize into action – because as filmmaker Joe Flynn puts it, the globalists have “overplayed their hand.”

“I think the American people are truly waking up – I think the left has very much overplayed their hand,” said Joe Flynn. “But, will they continue to try to stuff things down our throat and do things to try to crush us? They may.”

“If we get through this winter, they’re going to know their goose is cooked. But what they do when their goose is cooked is what I fear.”

 

Joe Flynn (left) describes how the next 18 months are crucial to America because the elite know they overplayed their hand.

Likewise, General Flynn shared a similar sentiment, saying the elite will usher in a controlled financial depression – or even an outright crash.

“They’re going to continue to focus on: how do they maintain control or how do they get better control,” said General Flynn. “I believe that we’re going to see a couple of things… I call it a controlled depression – some type of financial manipulation or collapse.”

General Flynn (right) warns Americans that the elite will have “no problem” financially ruining the middle class further by boosting the already drastic inflation rate.

Businessman Patrick Byrne agreed, adding that globalists are intentionally running the system into the ground so they can emerge from the rubble to control what’s left.

“There’s going to be a financial crash,” said Byrne. “The question is, do we emerge from the rubble as the USSA (the United Socialist States of America), or do we emerge as a USA stripped of the stuff that’s been going on since FDR did what got us here.”

Byrne (left) tells Alex Jones there’s absolutely no reason for Americans to get violent as he’s optimistic about the coming midterms.

Additionally, the crew breaks down the progress made in exposing election fraud, how an actual investigation into Jan 6 would expose the Deep State, and how vital it is for Americans to get involved by honoring their civic duty to preserve the America the founders created.

General Flynn tells all Americans: “These are the times now when you have to rise up and say, ‘I’m not going to put up with it anymore & I’m going to get involved in my civic duty as an American citizen to protect it for the generations that are going to follow us.”

Also, don’t miss the first half of Jones’ conversation with General Flynn where they discussed how to expose traitors in America’s government:

https://api.banned.video/embed/619548cf269aa852508b7d97

[Banned.VIDEO: Global Exclusive: General Michael T. Flynn Lays Out Plan To Save America And The World

Posted by The Alex Jones Show

Nov 17, 2021

MORE TO READ]

And of course, be sure to watch & share Alex Jones’ recent speech at the Reawaken America Tour in San Antonio, Texas:

https://api.banned.video/embed/619e7332db80e065c500cffe

[Banned.VIDEO: Alex Jones Delivers Powerful Speech At Reawaken America Tour

<div class=”ifw-player” data-video-id=”619e7332db80e065c500cffe”></div>https://infowarsmedia.com/js/player.js

Posted by The Alex Jones Show

Nov 24, 2021

MORE TO READ]

© 2021 NWO REPORT

They Did Not Take a Knee


Great post on Rittenhouse NOT GUILTY verdict!

No Thought Police

  1. Count One – Not Guilty!
  2. Count Two – Not Guilty!
  3. Count Three – Not Guilty!
  4. Count Four – Not Guilty!
  5. Count Five – Not Guilty!

An important day in history today when the Rittenhouse jury came out and bravely, and I say bravely came out and acquitted this young man!

The Rittenhouse story was more than just about a young man unjustly accused of murder but it was a story about all of us who still believe in the Constitution, the Bill of Rights, and our God given right to defend ourselves when we or a loved one’s lives are clearly in danger. Because self-defense and the right to bear arms in order to protect our lives and our families lives.

Today both Kyle Rittenhouse and self-defense won, thanks to a group of 12 brave Americans who were not going to listen to the lies and propaganda that’s been coming…

View original post 769 more words

Medical Tyranny & Documented Jab Deaths


John R. Houk, Blog Editor

November 16, 2021

PEOPLE NEED TO ASK THEMSELVES why reputed scientists and reputed medical doctors before COVID are vilified when they present science contradicting government controlled science which amazingly seems to fluctuate according to (Globalist-Marxist) government-control narratives.

Here is a case of vilification not based on science but the now ad hominem of conspiracy theory even in the face of scientific data! Dr. Mercola’s website presents the data starting with a video interview conducted by Michael Welch with Dr. Peter McCullough under the website Global Research.  

JRH 11/16/21

I need your generosity in 2021 via – credit cards, check cards

& debit cards are accepted by my PayPal account:

Please Support NCCR

Or if not donating you can support by getting in the Coffee from home business earning yourself extra cash – OR just buy some TASTE GOOD healthy coffee, that includes immune boosting products. Big Tech Censorship is pervasive – Share voluminously on all social media platforms!

**************************

COVID Jab Is Far More Dangerous Than Advertised

[Blog Editor: To date, Dr. Mercola only leaves website postings up for 48-hours after original postings to dampen political persecution.]

Analysis by Dr. Joseph Mercola

November 16, 2021

Mercola.com

Bitchute VIDEO: DR. PETER MCCULLOUGH – THE VACCINE IS MORE DANGEROUS THAN COVID-19

[Posted by Right2Freedom

Posted on October 27th, 2021 04:47 UTC

Source: https://www.globalresearch.ca/video-the-vaccine-is-more-dangerous-than-covid-19-dr-peter-mccullough/5759522

Dr. McCullough interviewed by Michael Welch

“The CDC and FDA are running the program. They are NOT the people who typically run vaccine programs! The drug companies run vaccine programs. So when Pfizer, Moderna, J&J ran their randomized trials, we didn’t have any problems! They had good safety oversight! They had data safety monitoring boards. The did okay! I mean I have to give the drug companies an okay.

“But the drug companies are now just the suppliers of the vaccine! Our government agencies are now just running the program. There’s no external advisory committee! There’s no data safety monitoring board! There’s no human ethics committee! NO ONE IS WATCHING OUT FOR THIS!

“And so, the CDC and FDA pretty clearly have their marching orders. Execute this program. That the vaccine is safe and effective. They’re giving NO REPORTS to Americans. No safety reports. We needed those once a month. They haven’t told doctors which is the best vaccine. Which is the safest vaccine. They haven’t told us what groups are to watch out for. How to we mitigate risks. Maybe there’s drug interactions. Maybe it’s people with prior blood clotting problems or diabetes.

“They’re not telling us anything! They literally are blindsiding us, and with no transparency, and now Americans are scared to death! You can feel the tension in America. People are walking off the job! They don’t want to lose their jobs! But they don’t want to die of the vaccine!

“It’s very clear! They say, “listen, I don’t want to die! That’s the reason I’m not taking the vaccine!” It’s just that clear!”]

STORY AT-A-GLANCE

  • According to a September 2021 analysis, based on conservative, best-case scenarios, the COVID shots have killed five times more seniors (65+) than the infection
  • In younger people and children, the risk associated with the COVID shot, compared to the risk of COVID-19, is bound to be even more pronounced
  • Data show higher vaccination rates do not translate into lower COVID-19 case rates
  • The COVID shots are an epic failure. The U.S. Centers for Disease Control and Prevention reports having more than 30,000 spontaneous reports of either hospitalizations and/or deaths among the fully vaccinated; data from the Centers for Medicare & Medicaid Services show 300,000 vaccinated CMS recipients have been hospitalized with breakthrough infections; 60% of seniors over age 65 hospitalized for COVID-19 have been vaccinated
  • 50% of reported deaths after COVID-19 “vaccination” occur within 24 hours; 80% occur within the first week. According to one report, 86% of deaths have no other explanation aside from a vaccine adverse event. A Scandinavian study concluded about 40% of post-jab deaths among seniors in assisted living homes are directly due to the injection

October 26, 2021, Global Research published an interview with Dr. Peter McCullough, in which he reviews and explains the findings of a September 2021 study published in the journal Toxicology Reports, which states:1

“A novel best-case scenario cost-benefit analysis showed very conservatively that there are five times the number of deaths attributable to each inoculation vs those attributable to COVID-19 in the most vulnerable 65+ demographic.

The risk of death from COVID-19 decreases drastically as age decreases, and the longer-term effects of the inoculations on lower age groups will increase their risk-benefit ratio, perhaps substantially.”

McCullough has impeccable academic credentials. He’s an internist, cardiologist, epidemiologist and a full professor of medicine at Texas A&M College of Medicine in Dallas. He also has a master’s degree in public health and is known for being one of the top five most-published medical researchers in the United States, in addition to being the editor of two medical journals.

Authors Defend Their Paper

Not surprisingly, the Toxicology Reports paper has received scathing critique from certain quarters. Still, corresponding author Ronald Kostoff told Retraction Watch that the criticism has actually been “an extremely small fraction” of the overall response, which by and large has been overwhelmingly positive and supportive. Kostoff went on to say:2

“Given the blatant censorship of the mainstream media and social media, only one side of the COVID-19 ‘vaccine’ narrative is reaching the public. Any questioning of the narrative is met with the harshest response …

I went into this with my eyes wide open, determined to identify the truth, irrespective of where it fell. I could not stand idly by while the least vulnerable to serious COVID-19 consequences were injected with substances of unknown mid and long-term safety.

We published a best-case scenario. The real-world situation is far worse than our best-case scenario, and could be the subject of a future paper.

What these results show is that we 1) instituted mass inoculations of an inadequately-tested toxic substance with 2) non-negligible attendant crippling and lethal results to 3) potentially prevent a relatively small number of true COVID-19 deaths. In other words, we used a howitzer where an accurate rifle would have sufficed!”

COVID Jab Campaign Has Had No Discernible Impact

Certainly, data very clearly show the mass “vaccination” campaign has not had a discernible impact on global death rates. On the contrary, in some cases the death toll shot up after the COVID shots became widely available. You can browse through covid19.healthdata.org3 to see this for yourself. Several examples are also included at the very beginning of the video.

This trend has also been confirmed in a September 2021 study4 published in the European Journal of Epidemiology. It found COVID-19 case rates are completely unrelated to vaccination rates.

Using data available as of September 3, 2021, from Our World in Data for cross-country analysis, and the White House COVID-19 Team data for U.S. counties, the researchers investigated the relationship between new COVID-19 cases and the percentage of the population that had been fully vaccinated.

Sixty-eight countries were included. Inclusion criteria included second dose vaccine data, COVID-19 case data and population data as of September 3, 2021. They then computed the COVID-19 cases per 1 million people for each country, and calculated the percentage of population that was fully vaccinated.

According to the authors, there was “no discernable relationship between percentage of population fully vaccinated and new COVID-19 cases in the last seven days.” If anything, higher vaccination rates were associated with a slight increase in cases. According to the authors:5

“[T]he trend line suggests a marginally positive association such that countries with higher percentage of population fully vaccinated have higher COVID-19 cases per 1 million people.”

The Kostoff Analysis

Getting back to the Toxicology Reports paper,6 which is being referring to as “the Kostoff analysis,” McCullough says the analysis is definitely making news in clinical medicine. The paper focuses on two factors: assumptions and determinism.

Determinism describes how likely something is. For example, if a person takes a COVID shot, it’s 100% certain they got the injection. It’s not 50% or 75%. It’s an absolute certainty. As a result, that person has a 100% chance of being exposed to whatever risk is associated with that shot.

On the other hand, if a person says no to the injection, it’s not 100% chance they’ll get COVID-19, let alone die from it. You have a less than 1% chance of being exposed to SARS-CoV-2 and getting sick. So, it’s 100% deterministic that taking the shot exposes you to the risks of the shot, and less than 1% deterministic that you’ll get COVID if you don’t take the shot.

The other part of the equation is the assumptions, which are based on calculations using available data, such as pre-COVID death statistics and death reports filed with the U.S. Vaccine Adverse Event Reports System (VAERS).

Mortality Data

As noted by McCullough, two reports have detailed COVID jab death data, showing 50% of deaths occur within 24 hours and 80% occur within the first week. In one of these reports, 86% of deaths were found to have no other explanation aside from a vaccine adverse event. McCullough also cites a Scandinavian study that concluded about 40% of post-jab deaths among seniors in assisted living homes are directly due to the injection. He also cites other eye-opening figures:

  • The U.S. Center for Disease Control and Prevention reports having more than 30,000 spontaneous reports of either hospitalizations and/or deaths among the fully vaccinated
  • Data from the Centers for Medicare & Medicaid Services show 300,000 vaccinated CMS recipients have been hospitalized with breakthrough infections
  • 60% of seniors over age 65 hospitalized for COVID-19 have been vaccinated

COVID Shots Are ‘Failing Wholesale’

“When we put all these data together, we have clear-cut science that the vaccines are failing wholesale,” McCullough says. The shots are particularly useless in seniors.

Again, based on a best-case conservative scenario, seniors are five times more likely to die from the shot than they are from the natural infection. This scenario includes the assumption that the PCR test is accurate and reported COVID deaths were in fact due to COVID-19, which we know is not the case, and the assumption that the shots actually prevent death, which we have no proof of.

All things considered, you are FAR better off taking your chances with the natural infection, as McCullough says. The Kostoff analysis also does not take into account the fact that there are safe and effective treatments.

It bases its assumptions on the notion that there aren’t any. It also doesn’t factor in the fact that the COVID shots are utterly ineffective against the Delta and other variants. If you take into account vaccine failure against variants and alternative treatments, it skews the analysis even further toward natural infection being the safest alternative.

FDA and CDC Should Not Run Vaccine Programs

While the U.S. Food and Drug Administration and the CDC claim not a single death following COVID inoculation was caused by the shot, they should not be the ones making that determination, as they are both sponsoring the vaccination campaign.

They have an inherent bias. When you conduct a trial, you would never allow the sponsor to tell you whether the product was the cause of death, because you know they’re biased.

What we need is an external group, a critical event committee, to analyze the deaths being reported, as well as a data safety monitoring board. These should have been in place from the start, but were not.

Had they been, the program would most likely have been halted in February, as by then the number of reported deaths, 186, already exceeded the tolerable threshold of about 150 (based on the number of injections given). Now, we’re well over 17,000.7 There’s no normal circumstance under which that would ever be allowed. 

“The CDC and FDA are running the [vaccination] program. They are NOT the people who typically run vaccine programs,” McCullough says. “The drug companies run vaccine programs.

When Pfizer, Moderna, J&J ran their randomized trials, we didn’t have any problems. They had good safety oversight. They had data safety monitoring boards. The did OK. I mean I have to give the drug companies [credit].

But the drug companies are now just the suppliers of the vaccine. Our government agencies are now just running the program. There’s no external advisory committee. There’s no data safety monitoring board. There’s no human ethics committee. NO one is watching out for this!

And so, the CDC and FDA pretty clearly have their marching orders: ‘Execute this program; the vaccine is safe and effective.’ They’re giving no reports to Americans. No safety reports. We needed those once a month. They haven’t told doctors which is the best vaccine, which is the safest vaccine.

They haven’t told us what groups are to watch out for. How to mitigate risks. Maybe there are drug interactions. Maybe it’s people with prior blood clotting problems or diabetes. They’re not telling us anything!

They literally are blindsiding us, and with no transparency, and Americans now are scared to death. You can feel the tension in America. People are walking off the job. They don’t want to lose their jobs, but they don’t want to die of the vaccine! It’s very clear. They say, ‘Listen, I don’t want to die. That’s the reason I’m not taking the vaccine.’ It’s just that clear.”

Bradford Hill Criteria Are Met — COVID Jabs Cause Death

McCullough goes on to explain the Bradford Hill criterion for causation, which is one of the ways by which we can actually determine that, yes, the shots are indeed killing people. We’re not dealing with coincidence.

“The first question we’d ask is: ‘Does the vaccine have a mechanism of action, a biological mechanism of action, that can actually kill a human being?’ And the answer is yes! because the vaccines all use genetic mechanisms to trick the body into making the lethal spike protein of the virus.

It is very conceivable that some people take up too much messenger RNA; they produce a lethal spike protein in sensitive organs like the brain or the heart or elsewhere. The spike protein damages blood vessels, damages organs, causes blood clots. So, it’s well within the mechanism of action that the vaccine could be fatal.

Someone could have a fatal blood clot. They could have fatal myocarditis. The FDA has official warnings of myocarditis. They have warnings on blood clots. They have warnings on a fatal neurologic condition called Guillain-Barré syndrome. So, the FDA warnings, the mechanism of action, clearly say it’s possible.

The second criteria is: ‘Is it a large effect?’ And the answer is yes! This is not a subtle thing. It’s not 151 versus 149 deaths. This is 15,000 deaths. So, it’s a very large effect size, a large effect.

The third [criteria] is: ‘Is it internally consistent?’ Are you seeing other things that could potentially be fatal in VAERS? Yes! We’re seeing heart attacks. We’re seeing strokes. We’re seeing myocarditis. We’re seeing blood clots, and what have you. So, it’s internally consistent.

‘Is it externally consistent?’ That’s the next criteria. Well, if you look in the MHRA, the yellow card system in England, the exact same thing has been found. In the EudraVigilance system in [Europe] the exact same thing’s been found.

So, we have actually fulfilled all of the Bradford Hill criteria. I’ll tell you right now that COVID-19 vaccine is, from an epidemiological perspective, causing these deaths or a large fraction.”

Zero Tolerance for Elective Drugs Causing Death

There may be cases in which a high risk of death from a drug might be acceptable. If you have a terminal incurable disease, for example, you may be willing to experiment and take your chances. Under normal circumstances however, lethal drugs are not tolerated.

After five suspected deaths, a drug will receive a black box warning. At 50 deaths, it will be removed from the market. Considering COVID-19 has a less than 1% risk of death across age groups, the tolerance for a deadly remedy is infinitesimal. At over 17,000 reported deaths, which in real numbers may exceed 212,000,8 the COVID shots far surpass any reasonable risk to protect against symptomatic COVID-19. As noted by McCullough:

“There is zero tolerance for electively taking a drug or a new vaccine and then dying! There’s zero tolerance for that. People don’t weigh it out and say, ‘Oh well, I’ll take my chances and die.’ And I can tell you, the word got out about vaccines causing death in early April [2021], and by mid-April the vaccination rates in the United States plummeted …

We hadn’t gotten anywhere near our goals. Remember, President Biden set a goal [of 70% vaccination rate] by July 1. We never got there because Americans were frightened by their relatives, people in their churches and their schools dying after the vaccine.

They had heard about it, they saw it. There was an informal internet survey done several months ago, where 12% of Americans knew somebody who had died after the vaccine.

I’m a doctor. I’m an internist and cardiologist. I just came from the hospital … I had a woman die of the COVID-19 vaccine … She had shot No. 1. She had shot No. 2. After shot No. 2, she developed blood clots throughout her body. She required hospitalization. She required intravenous blood thinners. She was ravaged. She had neurologic damage.

After that hospitalization, she was in a walker. She came to my office. I checked for more blood clots. I found more blood clots. I put her back on blood thinners. I saw her about a month later. She seemed like she was a little better. Family was really concerned. The next month I got called by the Dallas Coroner office saying she’s found dead at home.

Most of us don’t have any problem with vaccines; 98% of Americans take all the vaccines … I think most people who are still susceptible would take a COVID vaccine if they knew they weren’t going to die of it or be injured. And because of these giant safety concerns, and the lack of transparency, we’re at an impasse.

We’ve got a very labor-constrained market. We’ve got people walking off the job. We’ve got planes that aren’t going to fly, and it’s all because our agencies are not being transparent and honest with America about vaccine safety.”

Early Treatment Is Crucial, Vaxxed or Not

As noted by McCullough, the vast majority of patients require hospitalization for COVID-19 is because they’ve not received any treatment and the infection has been allowed free reign for days on end.

“To this day, the patients who get hospitalized are largely those who receive no early care at home,” he says. “They’re either denied care or they don’t know about it, and they end up dying.

The vast majority of people who die, die in the hospital; they don’t die at home. And the reason why they end up in the hospital, it’s typically two weeks of lack of treatment. You can’t let a fatal illness brew for two weeks at home with no treatment, and then start treatment very late in the hospital. It’s not going to work.

There’s been a very good set of analyses, one in the Journal of Clinical Infectious Diseases … that showed, day by day, one loses the opportunity of reducing the hospitalization when monoclonal antibodies are delayed … No doctor should be considered a renegade when they order FDA [emergency use authorized] monoclonal antibody. The monoclonal antibodies are just as approved as the vaccines.

I just had a patient over the weekend, fully vaccinated, took the booster. A month after the booster she went on a trip to Dubai. She just came back, and she got COVID-19! … I got her a monoclonal antibody infusion that day. [The following day] she started the sequence of multidrug therapy for COVID-19. I am telling you, she is going to get through this illness in a few days …

Podcaster Joe Rogan just went through this. Governor Abbott was also a vaccine failure. He went through it. Former President Trump went through it. Americans should see the use of monoclonal antibodies in high risk patients, followed by drugs in an oral sequenced approach. This is standard of care!

It is supported by the Association of Physicians and Surgeons, the Truth for Health Foundation, the American Front Line Doctors, and the Front Line Critical Care Consortium. This is not renegade medicine. This is what patients should have. This is the correct thing! …

If we can’t get the monoclonal antibodies, we certainly use hydroxychloroquine, supported by over 250 studies, ivermectin, supported by over 60 studies, combined with azithromycin or doxycycline, inhaled budesonide … full-dose aspirin … nutraceuticals including zinc, vitamin D, vitamin C, quercetin, NAC … we do oral and nasal decontamination with povidone-iodine.

In acutely sick patients we do it every four hours, [and it] massively reduces the viral load … Fortunately, we have enough doctors now and enouZZgh patient awareness, patients who … understand that early treatment is viable, is necessary, and it should be executed.”

The Truth About COVID-19” exposes the hidden agenda behind the pandemic, showing the countermeasures have nothing to do with public health and everything to do with ushering in a new social and economic system based on totalitarian, technocracy-led control. So, it’s not misinformation they fear. It’s the truth they want to prevent from spreading. Pick up a copy of this best-selling book today before it’s too late.

Sources and References

1, 6 Toxicology Reports September 2021; 8: 1665-1684

2 Retraction Watch October 4, 2021

3 Covid19.healthdata.org

4, 5 European Journal of Epidemiology September 30, 2021

7 OpenVAERS Data as of October 15, 2021

8 SKirsch.io/vaccine-resources

© 1997-2021 Dr. Joseph Mercola. All Rights Reserved.

Disclaimer: The entire contents of this website are based upon the opinions of Dr. Mercola, unless otherwise noted. Individual articles are based upon the opinions of the respective author, who retains copyright as marked. The information on this website is not intended to replace a one-on-one relationship with a qualified health care professional and is not intended as medical advice. It is intended as a sharing of knowledge and information from the research and experience of Dr. Mercola and his community. Dr. Mercola encourages you to make your own health care decisions based upon your research and in partnership with a qualified health care professional. If you are pregnant, nursing, taking medication, or have a medical condition, consult your health care professional before using products based on this content.

If you want to use an article on your site please click here. This content may be copied in full, with copyright, contact, creation and information intact, without specific permission, when used only in a not-for-profit format. If any other use is desired, permission in writing from Dr. Mercola is required.

+++++++++++++++++++++

[Blog Editor: Here some bonus medical tyranny info from Sarah Westall. She utilizes ads to pay the bills so might want to skip through that to get to the meat. I begin with her website post and use the Bitchute platform version (she offers many venues)]

Medical Mafia & The AMA – The Power Structure Taking US Down & Keeping US Sick W/ Dr. Glidden

11-15-2021

SarahWestall.com

AMA Medical Tyranny – Power Corrupts

Dr. Peter Glidden joins the program to discuss the American Medical Association and the Tyranny that we have been living under since Congress established laws forcing all Americans to follow only the AMA’s direction funded and controlled by the Pharmaceutical industry. This government/medical alliance has crippled the country and has led to more deaths and misery than anyone could ever have imagined. Learn the better alternative to a healthy life at ControlYourHealth.care

Members of Ebener and SarahWestll.tv see exclusive interview with Dr. Glidden. Learn the 2 simple nutritions, when deficient, causes heartburn.

See Important Proven Solutions to Keep Your from getting sick even if you had the mRNA Shot – Dr. Nieusma – Updated 10-11-21

Dr. Peter Glidden Biography

Dr. Peter Glidden

Dr. Peter Glidden is an outspoken advocate of Wholistic Health.  For more than two decades, he has been treating people with Naturopathic therapeutics including Homeopathy, Heavy Metal Chelation, Herbal Medicine and Bio-identical Hormone Supplementation.

Dr. Glidden received his BS degree from the University of Massachusetts in Amhurst.  He earned his ND from Bastyr University in Seattle, Washington.

Dr. Glidden currently has a private naturopathic practice in Illinois.  He is also a member of the American Association of Naturopathic Physicians and the Illinois Association of Naturopathic Physicians.

Bitchute VIDEO: MEDICAL MAFIA & THE AMA – THE POWER STRUCTURE TAKING US DOWN & KEEPING US SICK W/ DR. GLIDDEN

Posted by Sarah Westall – Business Game Changers

Posted on November 14th, 2021 18:45 UTC

Learn more at https://ControlYourHealth.care

Updated 10-11-21: Access solution resource document at https://sarahwestall.com/important-proven-solutions-to-keep-from-getting-sick-even-if-you-have-the-mrna-shot/

Dr. Peter Glidden joins the program to discuss the American Medical Association and the Tyranny that we have been living under since Congress established laws forcing all Americans to follow only the AMA’s direction funded and controlled by the Pharmaceutical industry. This government/medical alliance has crippled the country and has led to more deaths and misery than anyone could ever have imagined. Learn the better alternative to a healthy life at https://ControlYourHealth.care

Dr. Zelenko’s Vitamin Pack protects you from getting sick (an Ivermectin and Hydroxychloroquine alternative): https://zstacklife.com/products/z-stack?ref=hpkvvpuhn0

MORE TO READ

COVID Manchurian Brainwashing


COVID Manchurian Brainwashing

John R. Houk, Blog Editor

© October 18, 2021

Have you ever seen the movie “The Manchurian Candidate”? For a little clarity The Manchurian Candidate was first a 1959 novel, then a 1962 movie and finally to date a 2004 movie remake. You will not it this way from the Left-committed Wikipedia which I acquired the dates. NVERTHELESS, the movie (1962 is the best) is about how the Chinese Communist Party (CCP) and Communist Soviets brainwashed captured American soldiers in the Korean War to be planted back in the USA with a groomed to manipulate one of those soldiers to become POTUS via Machiavellian politics and assassinations.

The CCP and Dem-Marxists are undergoing The Manchurian Candidate experiment – QUITE SUCCESFULLY in my opinion – upon Americans with COVID brainwashing to accept the will of the transformed Big Brother State making Government-think the only reality.

Time is slipping away now seemingly daily for Americans to reclaim the heritage our Founders initiated.

Below are two relatively recent articles followed by a few videos awakens a few to refuse the brainwashing.

JRH 10/18/21

I need your generosity in 2021 via – credit cards, check cards & debit cards are accepted by my PayPal account:

Please Support SlantRight 2.0

Or if not donating, you can support by getting in the Coffee from home business earning yourself extra cash – OR just buy some TASTE GOOD healthy coffee, that includes immune boosting products. Big Tech Censorship is pervasive – Share voluminously on all social media platforms!

************************

COVID-19 Vaccine Facts Media Ignores, Part 3

By Roger Anghis

October 17, 2021

News With Views

Keep in mind that since the ‘vaccine’ came out they have told us that it is 100% safe. Most reporting says the opposite but when people don’t research anything all they do is believe what MSM is telling them. New VAERS numbers should scare the daylights out of anyone who is considering getting the jab. There have been 701,559 adverse events, 60,741 hospitalizations, 80,393 urgent care, 6,637 heart attacks, 5,765 myocarditis, 1,862 miscarriages, 19,210 disabled, and 14,925 deaths. More people have died from the COVID ‘vaccine’ than all other deaths from all other vaccines combined. Remember that these are just America’s numbers. In my last column, I reported that the European Union has reported 26,041 deaths, 2,448,362 injuries.[1] Why is the government demanding that the whole planet gets the ‘vaccine’? It surely isn’t for our health as it seems we’d be a whole lot healthier NOT taking the jab. You’ll also find out that any mention by MSM about these adverse effects is not allowed. This administration does not want the public to know about them.

It is being reported that in many places that there are high numbers of COOVID patients who are fully vaccinated: Israel: “85-90% of the hospitalizations are in fully vaccinated people”[2]Scotland: 70% of Covid deaths and 58% of hospitalizations are fully vaccinated.[3] The illegals coming across our southern border are testing up to 20% positive: Over 20 percent of illegal immigrant unaccompanied minors and 18 percent of family units who recently crossed the U.S.-Mexico border have tested positive for COVID-19 prior to being released from U.S. Customs and Border Protection custody over the last several weeks, according to a Department of Homeland Security document prepared for President Joe Biden and reviewed by NBC News Saturday.

The document also said some flights being used to deport illegal immigrants had over 25 percent of the passengers test positive before leaving, forcing Immigration and Customs Enforcement (ICE) to remove the sick illegal immigrants and place them in quarantine.

“In the last 2-3 weeks, the percent positivity rates among all demographics has increased,” the document says.[4] Biden isn’t requiring them to get the ‘vaccine’ but he’s demanding that the border patrol get it or get fired.  Biden is also shipping the infected illegals to red states with low numbers of cases. Tell me again Biden is demanding people to get the jab for our health’s sake and I’ll have to call you a liar. It’s more proof that the Democrats hate America and will do anything to bring her down.

In an article from the Washington Post, there is a call for anyone traveling from one state to another to show proof of vaccination. Requiring vaccination for travel is hardly radical. The U.S. government has been considering a mandate for people flying into the United States from foreign countries. It’s already required for Americans to fly internationally if they don’t want to quarantine for 10 or more days in Germany, Britain, and other destinations. These policies have allowed international travel to resume. More than a month ago, Canada announced a vaccine mandate for interprovincial travel on all forms of public transport. We should follow our neighbor’s lead.

Such a mandate would be straightforward to create, based on protecting federal employees from the infection risks created by unvaccinated travelers. Transportation Security Administration staff are exposed daily to thousands of unvaccinated people who pass through security checkpoints.

Of course, there will be pushback. But cries of “freedom” and “personal choice” are hollow and politically motivated. Our freedom is not unlimited.[5] This sounds like 1930s Germany with security checkpoints at the border. Notice that they mock our demand for freedoms and personal choice.

Rand Paul questioned Xavier Becerra recently about the science behind the ‘vaccine’ and Paul destroyed Becerra’s defense of demanding everyone get the ‘vaccine’ with common sense but Becerra held to the left’s narrative. Paul even stated that it was obvious that they were just demanding that we comply and ask no questions. The following article, ‘Ignoring the Science’: Sen. Rand Paul Exposes HHS Secretary Xavier Becerra for ‘Lying To People About Natural Immunity’ for COVID-19, was first published on Big League Politics.

Sen. Rand Paul (R-KY) grilled HHS Secretary Xavier Becerra on Thursday for “lying to people about natural immunity” to COVID-19 as well as “ignoring science.”

“Mr. Becerra, are you familiar with an Israeli study that had 2.5 million patients and found that the vaccinated group was actually seven times more likely to get infected with Covid than the people who had gotten Covid naturally?” Paul asked the health bureaucrat during a Senate Health Committee hearing.

“I’m not familiar with that,” Becerra said in response, feigning ignorance with the well-publicized study.

“I think you might want to be if you’re going to travel the country insulting the millions of Americans, including NBA star Jonathan Isaac, who had Covid, recovered, look at a study with 2.5 million people, and say, well, you know what, I should make the decision. Instead, you’ve called Jonathan Isaac and others, myself included, flat earthers,” Paul clapped back. “We find that very insulting… Are you a doctor or a medical doctor?” the liberty-loving senator asked.

“I have worked for over 30 years on health policy,” Becerra said.

This is when Paul went in for the killshot on the paid shill for Big Pharma.

“You’re not a medical doctor. Do you have a science degree? And yet you travel the country, calling people flat earthers, who have had Covid, looked at studies of millions of people, and made their own personal decision that their immunity they naturally acquired is sufficient but you presume somehow to tell over 100 million Americans who survived Covid that we have no right to determine our own medical care,” Paul said.[6]

There is more and more evidence coming out that this is more than a health issue. It is obvious that the left is making a power play to get all the power they can. Even the Supreme Court is completely ignoring our constitutional rights and their constitutional obligation.  They ignored their responsibility to review the evidence of voter fraud and on October 1st Sotomayor denies New York school teachers the right to make medical decisions for themselves about their own health. Supreme Court Justice Sonia Sotomayor has denied a request by a group of New York City teachers to block the city’s vaccine mandate for Department of Education staff.

Sotomayor did not request an additional briefing and also did not refer the request to the full court.

As the Supreme Court Justice overseeing the Second Circuit, Sotomayor has the discretion to address emergency applications on her own.

Four New York Teachers had claimed in a petition that a vaccine mandate had violated their right to due process and equal protection. 

The roughly 148,000 school employees in New York City had until 5 p.m. Friday to get a least their first dose of the COVID-19 vaccination or face suspension without pay when schools open on Monday.[7]

The fourteen days to flatten the curve has turned into almost twenty months with no end in sight, lockdowns, mask mandates, vaccine mandates, and the loss of our right to work and shop unless we take what has been proven to be a very dangerous gene therapy shot not a ‘vaccine’. If we don’t stand now we won’t have that right in a very short time. The Democrats will see to it.

© 2021 Roger Anghis – All Rights Reserved

E-Mail Roger Anghis: roger@buildingthetruth.org

Foot Notes

1. 26,041-deaths, 2,448.362-injuries-following-covid-shots-in-european-unions-database-as-slovenia-suspends-jj-shot-after-death-of-20-year-old-student

2. Israel-85-90-of-the-hospitalizations-are-in-fully-vaccinated-people

3. Scotland-70-of-covid-deaths-and-58-of-hospitalizations-are-fully-vaccinated

4. Illegal-immigrant-coming-into-us-have-covid-19-report-says

5. Biden-must-mandate-vaccines-travel

6. Sen Rand Paul exposes HHS secretary Xavier Becerra for lying to people about natural immunity for covid 19

7. Justice Sotomayor-denies-nyc-teachers-request-to-block-vaccine-mandate

Roger Anghis is the Founder of BuildingtheTruth.org, an organization designed to draw attention to the need of not just free speech for churches but disseminating correct information through responsible journalism.

Copyright 2021 All Rights Reserved NEWSWITHVIEWS.COM

++++++++++++++++++

US Set to Pay $712 per Patient for Merck’s COVID-19 Pill

Molnupiravir – Merck’s antiviral against COVID-19 is seen in an undated image. (Merck & Co. via AP)

By Zachary Stieber

October 16, 2021 Updated: October 17, 2021

The Epoch Times

Merck & Co. is set to receive $712 per treatment course for its COVID-19 antiviral pill from the U.S. government—even as it costs a fraction of that amount to produce and is reportedly on track for a price of $12 in India.

The gap between production costs and the price for molnupiravir is wide and emblematic of a problem that some say requires Congress or the U.S. government to intervene by implementing price caps, or utilizing so-called march-in rights. Others, though, warn that such measures would curb innovation and lead to fewer drugs coming onto the market.

Merck filed for emergency use authorization from the Food and Drug Administration for the oral drug last week, after it said an interim analysis of trial data shows it cut hospitalizations in COVID-19 patients. An FDA advisory panel will consider the drug in November.

The treatment, a collection of pills given over five days, would be the first of its kind since the pandemic started.

Originally developed by Emory University with U.S. government funding, the drug was licensed by Ridgeback Biotherapeutics last year. Efforts to win authorization during the Trump administration were stymied, leading Ridgeback to turn to Merck.

Researchers this month pegged the cost of production for the five-day treatment course at $17.74 (pdf) and estimated that Merck could make a sustainable amount even if it priced a course as low as $19.99.

Melissa Barber of the Harvard T.H. Chan School of Public Health and Dzintars Gotham of the King’s College Hospital used the cost of the active pharmaceutical ingredient and other numbers to calculate the estimate.

The U.S. government committed last year to obtain 1.2 billion treatment courses if the drug received regulatory clearance. According to a contract (pdf) obtained by Knowledge Ecology International, the cost of each treatment would be $712.

“This price is equal to about 35 times the estimated sustainable generic price,” Barber and Gotham said.

It’s also 46 times as much as Indian manufacturers plan to charge for a generic version, according to Leena Menghaney, the South Asia head of Médecins Sans Frontières’ Access Campaign.

“The molnupiravir case illustrates why the ‘TRIPS Waiver’ is so urgently needed, which would waive intellectual property for COVID-19 medical tools during the pandemic and would remove legal barriers so that countries the world over could produce versions of these medicines and more lives could be saved,” she said in a statement, referring to a proposal to waive intellectual property rights for COVID-19 vaccines and treatments.

Merck officials didn’t respond to requests for comment. After public criticism of the cost of the company’s antiviral, an executive, Dr. Nicholas Kartsonis, said the price it charged the U.S. government isn’t the final figure.

“We set that price before we had any data, so that’s just one contract,” Kartsonis told the Associated Press. “Obviously we’re going to be responsible about this and make this drug as accessible to as many people around the world as we can.”

Merck in a statement on Oct. 11 said it’s “committed to providing timely access to molnupiravir globally, if it is authorized or approved, and plans to implement a tiered pricing approach based on World Bank country income criteria to reflect countries’ relative ability to finance their health response to the pandemic.”

A logo of drugs and chemicals group Merck is pictured in Darmstadt, Germany, in a file photograph. (Ralph Orlowski/Reuters)

Cheaper Than Other Treatments

While hydroxychloroquine and other drugs approved for various afflictions but used as off-label COVID-19 treatments cost much less, they aren’t recommended by federal authorities to treat COVID-19. The few cleared as COVID-19 treatments cost more than Merck’s drug.

Remdesivir, the only approved treatment for hospitalized patients, costs an estimated $5 (pdf) to produce and was sold to the U.S. government for $2,340 a course—a price now pegged as too high for many patients. Monoclonal antibody courses, used to treat mild or asymptomatic COVID-19 cases, cost around $2,100 per course. The cost of production for the monoclonals isn’t clear.

Merck’s drug “is lower than a lot of the other treatments right now for COVID” and “certainly a lot cheaper in the United States of ending up in a hospital,” James Love, director of Knowledge Ecology International, told The Epoch Times.

“On the face of it, that doesn’t seem to be, initially, an irresponsible pricing decision for Merck,” he said.

The average COVID-19 hospitalization costs $34,662 to $45,683, according to data crunched by FAIR Health (pdf).

If regulators do find the drug safe—there are concerns it could lead to the development of cancer—and authorize it in the United States, the calculus could change.

“Suppose that a new variant ended up infecting a significant percentage of the U.S. population and the drug was needed for 1 million, 10 million, or 50 million persons. At some point, the price just isn’t reasonable,” Love said in an email.

Dr. Roger Klein, a health policy expert who currently advises The Heartland Institute, doesn’t see the gap as a big deal, given that developing treatments are “really high-risk endeavors” that cost a lot of money, including millions of dollars just to run clinical trials.

“We don’t know how long these drugs are going to have a market within the United States, which is the world’s most important drug market in many ways,” he told The Epoch Times, adding that he believes the public health crisis from the pandemic is close to being over because of an increasing number of people gaining immunity through vaccination or prior infection.

Every treatment costs much more than vaccines. The shots have all been priced under $20 a dose, according to contracts between vaccine makers and the U.S. government.

A sign is posted in front of Gilead Sciences headquarters in Foster City, Calif., on April 29, 2020. (Justin Sullivan/Getty Images)

March-in Rights

One possible approach to lowering drug prices is utilizing various provisions of the Bayh–Dole Act of 1980, some experts say.

The act let the federal government retain some rights for inventions produced with government funding. It also enables federal agencies to use known as march-in rights, through which the government in certain circumstances can require a company to grant a license for a drug to an applicant. The government can grant the license itself if the patent owner refuses.

Some experts and advocates say march-in rights can be used to ease drug prices or provide leverage in negotiations on prices.

Thirty-one state attorneys general called last year on the federal government to exercise march-in rights on remdesivir to boost supply and lower its price.

“Here, we think it is clear that Gilead has not established a reasonable price, nor has it met the health and safety needs of the public given the COVID-19 pandemic,” they wrote (pdf).

However, no federal agency has ever exercised the power, according to the Congressional Research Service and opponents say the law has only narrow application.

The National Institutes of Health (NIH) has said multiple times the act doesn’t authorize it to set prices, Dr. Mark Rohrbaugh, special adviser for technology transfer at the NIH, said during a panel discussion last year held by the Bayh–Dole 40 Coalition and Information Technology and Innovation Foundation. No other federal agency has disagreed with this position, he said.

Both the Trump and Biden administrations have rebuffed those calls and other efforts to cap prices during the pandemic.

“We can’t control that price because we need the private sector to invest,” Alex Azar, the health secretary at the time, said during a congressional hearing in February 2020.

Even if march-in rights can’t be used, the government can negotiate prices, others say.

The government’s funding and involvement with setting contracts with hospitals for remdesivir should have led to price concessions, Dr. Peter Bach, director of the Center for Health Policy and Outcomes at the Memorial Sloan Kettering Cancer Center, said during an Institute for Clinical and Economic Review (ICER) panel discussion last year.

Public Citizen, an advocacy group, has urged the Biden administration to use executive authority to impose “a reasonable pricing requirement” so that “taxpayers don’t pay twice for medicine developed with public funds—first funding research and development, and again through excessive prices.”

Gilead and Eli Lilly, which produces monoclonals, did not respond to requests for comment. A GlaxoSmithKline spokeswoman declined to provide information on the cost of production for the antibodies. A Regeneron spokesman told The Epoch Times in an email that monoclonals “are complex to develop and manufacture, requiring time, specialized facilities and expertise, hence the higher cost of this class vs. vaccines.”

“Monoclonal antibodies are intended primarily as treatment, and so also have cost-effectiveness in being administered only to high-risk patients who are otherwise likely to be hospitalized, as opposed to vaccines which are intended to be administered to all,” he added.

A Regeneron monoclonal antibody infusion bag is seen during a news conference in Fort Lauderdale, Fla., on Aug. 19, 2021. (Joe Cavaretta/South Florida Sun-Sentinel via AP)

Quest to Revamp Pricing

Prices can vary based on a number of factors, Merck says in a fact sheet, including value to patients and health care systems and the investment into research and development.

Other factors include what the market is willing to pay and the number of alternatives, according to Joey Mattingly, associate professor and vice chair of academic affairs at the University of Maryland School of Pharmacy’s Department of Pharmaceutical Health Services Research. The volume of sales also plays a role, as do getting large contracts from governments.

Drugmakers have long been accused of charging too much for products, especially drugs for rare diseases. Some experts and lawmakers have pushed to revamp the drug pricing system, but the issue has bedeviled Congress since the 1950s.

An agreement was close in the 1960s on a proposal by then-Sen. Estes Kefauver (D-Tenn.) to implement pricing caps and other ideas currently supported among some members of both parties. But Kefauver couldn’t ultimately secure enough votes, and the Kefauver–Harris Amendment that eventually passed focused primarily on drug safety and efficacy.

“There’s a lot of proposals out there, good or bad, and we’ll just see if it has the votes and the things that don’t have the votes will fall out and we’ll keep talking about it and then depending on how elections go over the next 10 years, maybe there will [be a change], but I’m not holding my breath, just because I know we’ve been on this journey for 60 years,” Mattingly said.

Zachary Stieber covers U.S. news, including politics and court cases. He started at The Epoch Times as a New York City metro reporter.

Copyright © 2000 – 2021 The Epoch Times

+++++++++++++++++++++++++++++

Blog Editor: Here are two important videos I found via subscribing to Geri Ungurean’s blog Absolute Truth from the Word of God. As a Hat Tip here’s the title she used: Glazov Gang : HORROR “Vaccine” VIALS Under the Microscope: Vera Sharav: COVID Vaccine Mandates & NAZI Tactics “Auschwitz did not begin with Auschwitz.” THE HORRIFIC TRUTH Finally Being Unveiled and the TRUTH is SCARIER than Any HORROR MOVIE Ever Made (VIDEOS). Lengthy title to a couple of informative videos based on science and experience Dem-Marxist controller/propagandists just as soon you NOT watch.

Rumble VIDEO: Horror: Covid ‘Vaccine’ Vials Under the Microscope.

Posted by The Glazov Gang

Published October 15, 2021

Horror: Covid ‘Vaccine’ Vials Under the Microscope.
Dr. Carrie Madej (Osteopathic Internal Medicine Physician)

++++++++++++++++++++

Rumble VIDEO: Holocaust Survivor on Covid Vaccine Mandates & Nazi Tactics

Posted by The Glazov Gang

Published October 2, 2021 

Vera Sharav (Founder, Alliance for Human Research Protection)

Christian Challenge:


Wake Christians and bravely FOLLOW the Word of God rather than the testimony of humans contradicting God’s Word!

United States Patriot News

Christians these days seem scared and weak. Possibly due to most of those who claim the christian badge are not what they claim. “For a good tree bringeth not forth corrupt fruit; neither doth a corrupt tree bring forth good fruit.  For every tree is known by his own fruit..” (Luke 6:43-45 AKJV) What is this fruit that they speak of? What is a fruit at it’s core? Something produced from a plant to provide nourishment.

So one’s fruit is that which they produce to share or feed the populous. “ But the fruit of the Spirit is love, joy, peace, longsuffering, gentleness, goodness, faith,  meekness, temperance: against such there is no law.” (Gal. 5:22-23 AKJV) Are you producing these as a christian? No where did it say weakness, quietness, selfishness, pacifistic or begging God for earthly riches because you pay 10%.

I remember a popular phrase…

View original post 1,248 more words

The TRUTH vs The Big Lie | Cyber Symposium Reveals Shocking New Data


Yesterday I posted Day 3. This post has great abbreviated info about Day 3.

Nwo Report

Source:Jim Hoft

The Cyber Symposium, which is set to expose the mass voter fraud started on Tuesday and revealed some very shocking new data.

Before Tuesday on Monday, Mike Lindell announced that a mock election was set to be held, and interactive fraud displays would be available while teams broke off to analyze cyber data.

The interactive displays at the symposium reveal the recorded results versus the alleged real results for every state in “THE BIG LIE” vs. “THE TRUTH”.

TRENDING:Mike Lindell Opens Thursday Cyber Symposium with SHOCKING Developments: Another Home Raided, Credible Threats, Conference Infiltrated

“The Truth” in Pennsylvania

One can use this interactive computer to click on a category under any state’s name. There are two categories, “The Truth” and “The Big Lie”.

***To support Mike Lindell and benefit Gateway Pundit, use promo code TGP at MyPillow.com***

The Big Lie section shows the official 2020 election…

View original post 147 more words

%d bloggers like this: